Police wrongly seize photographer's camera after crash
in [UK Photography]
|
Prev: Home Secretary announces review of ant-terror legislation
Next: Compact Digital with Viewfinder.
From: Phil Stovell on 22 Jul 2010 11:50 It didn't take long. http://www.bbc.co.uk/news/uk-england-berkshire-10712745 Police wrongly seize photographer's camera after crash An investigation is under way after police seized a photographer's camera and images were later deleted from it. Paul King was taking pictures of a crash in Wokingham, Berkshire, when he was confronted by a traffic officer. Mr King said he was acting within the law and the action, on Tuesday, cost him up to £400 in loss of earnings. Thames Valley Police returned the camera with images they put on to a disc. The National Union of Journalists (NUJ) said it would investigate. Mr King, who has 25 years experience as a news photographer, works across the Thames Valley supplying images to the media. The photographer, from Reading, attended the scene of the three-vehicle crash on Easthampstead Road on Tuesday, after those injured had been taken to hospital. 'Legal advice' "The officer came after me in a police car, grabbed hold of me and told me he was going to arrest me," he said. "He took my equipment but when it was brought back I had a look at the images and they were not there. "I have made a formal complaint to the police and I am seeking legal advice from the NUJ. "My role is to photograph news so the general public can see what's going on." Thames Valley Police confirmed the camera had been seized and a complaint had been made. Police car at crash scene Police were called to the crash which involved three vehicles "A roads policing inspector immediately called the photographer and his camera and images were returned to his home address," they said. "The force understands that journalists have a duty to take photographs and film from the scene of many of the incidents we deal with and we are committed to working alongside the media. "The incident will now be fully investigated and it would be inappropriate to comment further." John Toner, national freelance organiser for the NUJ, said he was "incensed" by the actions. "Photographers have been having serious problems with the police for a number of years and we have made representation to various forces. "This police officer or whoever has deleted these images is very likely to have committed an offence. "The Home Office reiterated that last year in this country everyone has the right to take photographs in a public place. "We will certainly be examining this in more detail to assist the photographer."
From: winston on 22 Jul 2010 12:17 > It didn't take long. > > http://www.bbc.co.uk/news/uk-england-berkshire-10712745 > > Police wrongly seize photographer's camera after crash > > An investigation is under way after police seized a photographer's camera > and images were later deleted from it. > > Paul King was taking pictures of a crash in Wokingham, Berkshire, when he > was confronted by a traffic officer. > > Mr King said he was acting within the law and the action, on Tuesday, cost > him up to �400 in loss of earnings. > > Thames Valley Police returned the camera with images they put on to a > disc. The National Union of Journalists (NUJ) said it would investigate. > > Mr King, who has 25 years experience as a news photographer, works across > the Thames Valley supplying images to the media. > > The photographer, from Reading, attended the scene of the three-vehicle > crash on Easthampstead Road on Tuesday, after those injured had been taken > to hospital. > > 'Legal advice' > > "The officer came after me in a police car, grabbed hold of me and told me > he was going to arrest me," he said. > > "He took my equipment but when it was brought back I had a look at the > images and they were not there. > > "I have made a formal complaint to the police and I am seeking legal > advice from the NUJ. > > "My role is to photograph news so the general public can see what's going > on." > > Thames Valley Police confirmed the camera had been seized and a complaint > had been made. Police car at crash scene Police were called to the crash > which involved three vehicles > > "A roads policing inspector immediately called the photographer and his > camera and images were returned to his home address," they said. > > "The force understands that journalists have a duty to take photographs > and film from the scene of many of the incidents we deal with and we are > committed to working alongside the media. > > "The incident will now be fully investigated and it would be inappropriate > to comment further." > > John Toner, national freelance organiser for the NUJ, said he was > "incensed" by the actions. > > "Photographers have been having serious problems with the police for a > number of years and we have made representation to various forces. > > "This police officer or whoever has deleted these images is very likely to > have committed an offence. > > "The Home Office reiterated that last year in this country everyone has > the right to take photographs in a public place. > > "We will certainly be examining this in more detail to assist the > photographer." > If they can get away with Tomlinson, a camera isn't going to stand in their way of anything . If plod had known about Tomlinson's 'attack' video before it hit the Guardians pages, that would have been 'nicked' as well... Totally out of control plod , and their bosses, right to the top.......
From: Phister on 22 Jul 2010 13:00 Corrupt masonic (sorry moronic) influence. -- DNA signature encryption key........ ATTGGTGCATTACTTCAGGCTCT
From: Richard Miller on 22 Jul 2010 16:36 In message <pan.2010.07.22.15.50.20.386202(a)stovell.nospam.org.uk>, Phil Stovell <phil(a)stovell.nospam.org.uk> writes >It didn't take long. > >http://www.bbc.co.uk/news/uk-england-berkshire-10712745 > >Police wrongly seize photographer's camera after crash > >An investigation is under way after police seized a photographer's camera >and images were later deleted from it. > Deleting the photographs amounts to criminal damage, and the officer who did it should be prosecuted. I'm not holding my breath though. -- Richard Miller
From: Mike Ross on 22 Jul 2010 17:46
On Thu, 22 Jul 2010 21:36:50 +0100, Richard Miller <richard(a)seasalter0.demon.co.uk> wrote: >In message <pan.2010.07.22.15.50.20.386202(a)stovell.nospam.org.uk>, Phil >Stovell <phil(a)stovell.nospam.org.uk> writes >>It didn't take long. >> >>http://www.bbc.co.uk/news/uk-england-berkshire-10712745 >> >>Police wrongly seize photographer's camera after crash >> >>An investigation is under way after police seized a photographer's camera >>and images were later deleted from it. >> > >Deleting the photographs amounts to criminal damage, and the officer who >did it should be prosecuted. > >I'm not holding my breath though. Don't hold your breath, but maybe the officer will indeed end up prosecuted. This case is sufficiently egregious that, even if the police decline to prosecute, the NUJ might well bring a private prosecution, to settle the issue publicly and permanently. Mike -- http://www.corestore.org 'As I walk along these shores I am the history within' |